Open Access

The adhesion modulation protein, AmpA localizes to an endocytic compartment andinfluences substrate adhesion, actin polymerization and endocytosis invegetative Dictyostelium cells

  • Elizabeth F Noratel1,
  • Chere’ L Petty1,
  • Jessica S Kelsey1,
  • Hoa N Cost1,
  • Nisha Basappa1 and
  • Daphne D Blumberg1Email author
BMC Cell Biology201213:29

DOI: 10.1186/1471-2121-13-29

Received: 30 May 2012

Accepted: 22 October 2012

Published: 5 November 2012

Abstract

Background

AmpA is a secreted 24Kd protein that has pleiotropic effects onDictyostelium development. Null mutants delay development atthe mound stage with cells adhering too tightly to the substrate. Prestalkcells initially specify as prespore cells and are delayed in their migrationto the mound apex. Extracellular AmpA can rescue these defects, but AmpA isalso necessary in a cell autonomous manner for a nteriorl ike c ells (ALCs) to migrate to the upper cup. The ALCsare only 10% of the developing cell population making it difficult to studythe cell autonomous effect of AmpA on the migration of these cells. AmpA isalso expressed in growing cells, but, while it contains a hydrophobic leadersequence that is cleaved, it is not secreted from growing cells. This makesgrowing cells an attractive system for studying the cell autonomous functionof AmpA.

Results

In growing cells AmpA plays an environment dependent role in cell migration.Excess AmpA facilitates migration on soft, adhesive surfaces but hindersmigration on less adhesive surfaces. AmpA also effects the level of actinpolymerization. Knockout cells polymerize less actin while over expressingcells polymerize more actin than wild type. Overexpression of AmpA alsocauses an increase in endocytosis that is traced to repeated formation ofmultiple endocytic cups at the same site on the membrane. Immunofluorescenceanalysis shows that AmpA is found in the Golgi and colocalizes with calnexinand the slow endosomal recycling compartment marker, p25, in a perinuclearcompartment. AmpA is found on the cell periphery and is endocyticallyrecycled to the perinuclear compartment.

Conclusion

AmpA is processed through the secretory pathway and traffics to the cellperiphery where it is endocytosed and localizes to what has been defined asa slow endosomal recycling compartment. AmpA plays a role in actinpolymerization and cell substrate adhesion. Additionally AmpA influencescell migration in an environment dependent manner. Wild type cells show verylittle variation in migration rates under the different conditions examinedhere, but either loss or over expression of AmpA cause significant substrateand environment dependent changes in migration.

Keywords

Actin polymerization Endocytosis Substrate adhesion Migration Dictyostelium discoideum

Background

Cell migration plays a vital role in many cellular processes, including neural crestmigration and gastrulation in the embryo, immune responses and cancer metastasis. Inorder for these processes to proceed, there has to be an optimal level of celladhesion [1]. If the adhesion to the substrate is too weak relative to the contractileforce exerted by the cell, cells spread inefficiently and traction is reduced.Strong adhesion relative to contractile force causes the cells to spread correctlybut to lose the ability to regulate the adhesion and the cells remain adhered to thesubstrate. Both of the above cases lead to inefficient motility. An optimal level ofactin polymerization is also required [2].

Actin polymerization takes place at the leading edge of migrating cells [3]. This process is tightly controlled and involves severing proteins,capping proteins and nucleating proteins (reviewed in [4]). In mammalian cells, integrins bind to the extracellular matrix, sendingsignals from the matrix back into the cell. Depending on the signal from the ECM,the cell either will adhere to the matrix and continue growth, division or migrationor will differentiate [5]. Cells form focal adhesions at sites of integrin binding which recruitactin binding proteins, such as Arp2/3, that induce actin polymerization [6]. Thus, actin polymerization and adhesion are irrevocably coupled in theprocess of cell migration.

The model organism Dictyostelium discoideum is uniquely suited for the studyof cell migration and chemotaxis. It is a haploid protist which is ideal for geneticmanipulation, and its genome has been sequenced [7]. Its life cycle consists of a vegetative state in which it survives innature on the forest floor. It feeds by chemotacting to and consuming bacteria [8]. When resources become scarce, the program of development begins [9].

There are several points during development where the cells must migrate in order fordevelopment to proceed correctly. As nutrients become scarce, a progenitor cellsecretes a signal indicating to other cells that starvation is imminent. Cellsreceiving this signal begin to secrete cAMP, a chemoattractant signal foraggregation. Cells then migrate into aggregation centers, initially moving as singlecells, but later in the process they form end to end and side to side contacts,streaming in a “daisy chain” like manner to create the multi-cellularmounds (reviewed in [9, 10]). At this point the cells differentiate into pre-spore and pre-stalkcells, along with a subset of pre-stalk cells called Anterior Like Cells(ALC’s). The cells migrate through the mound to their appropriate positions [11]. As development continues, the ALC’s prove to be the most migratoryof the cells. They are initially found at the mound periphery and then a subset ofthe ALCs migrate to the tip of the mound. Their swirling migration pattern is adriving force in culmination, where they form the upper and lower cups supportingthe sorus and the basal disk supporting the stalk [12, 13].

The question that arises is how cells regulate their adhesions, both to the widevariety of substrates that Dictyostelium finds in the forest and to othercells during multicellular development. No true integrins have been found in theDictyostelium genome, although some proteins with homology to integrinβ have been discovered to have roles in cell adhesion [14, 15]. Dictyostelium has genes coding for homologues of paxillin andtalin proteins, suggestive of an ability to form focal adhesions, although evidencefor the presence of focal adhesions is unclear [16, 17]. Interestingly, there are two different talin genes. The talB genefunctions primarily in development when cells are migrating over each other duringmorphogenesis; the talA gene functions primarily during growth when cells migrate ona wide variety of substrates from dirt to cellulous nitrate filters to glass andplastics [17]. Recent work seems to indicate that the two talin proteins also have someoverlapping functions [18]. How cells modify their adhesions to accommodate so many differentsubstrates is not trivial.

We have previously described a novel adhesion protein, A dhesionM odulation P rotein A (AmpA), that plays a role in cell migrationand adhesion during development [1921]. During development, about 70% of the AmpA protein is secreted, but asmall proportion remains cell associated [19]. When the ampA gene is knocked out, cells reach mound stage atthe same time as wildtype, but there is a 4 to 6 hour delay in tip formationcompared to wild type. Cells at the mound periphery that would normallydifferentiate as prestalk cells initially express prespore genes. They remain at themound periphery and are delayed in their migration to the tip of the mound. A largepercentage of the cells show significantly increased adhesion to the substrate inthe AmpA knockouts suggesting that the increased cell substrate adhesion may beresponsible for the delayed migration of the prestalk cells to the mound apex [19, 20]. In chimeras of wild type and ampA null cells, most of thesedefects are rescued by the presence of secreted AmpA protein suggesting that AmpAacts extracellularly. However, AmpA also plays an internal, cell autonomous role inregulating the migration of ALCs. In wild type-AmpA null chimeras, ALCs carrying theampA null mutation never migrate to the upper cup region. They remainat the base of the mound. The upper cup region forms entirely from wildtype cells inthe chimeras. Using reporter constructs, it was shown that AmpA is expressed in allgrowing cells and in scattered cells during early development, but its expressionbecomes entirely localized to the ALCs as development proceeds [22]. Since the ALC’s comprise only about 10% of the cells in the finalfruiting body, studying the role of AmpA in the migration of these cells isdifficult [23].

During vegetative growth, AmpA is expressed in all cells especially as they reachhigh density and, unlike in developing cells, AmpA is not secreted during growth [19, 22]. It contains a hydrophobic leader sequence which is cleaved but the AmpAprotein is never found free in the media in growing cells. Thus, growing cellsrepresent an opportunity to study the cell autonomous functions of AmpA. Here, wedemonstrate a role for the presence of AmpA causing a decrease in cell adhesion tothe substrate and thereby promoting cell migration. Depending on environmentalconditions, an optimal amount of AmpA is required for chemotaxis of growing cells tofolic acid which is thought to be the bacterial chemoattractant [24]. Loss of AmpA or excessive AmpA results in cells that are only able tomigrate efficiently under certain conditions. We also show a role for AmpA ininfluencing actin polymerization and we show that excess AmpA can increase theamount of endocytosis. Based on the localization of AmpA on the cell surface and itsendocytosis and subsequent localization to a perinuclear recycling compartment, wepostulate a role for AmpA in possibly controlling the recycling of an adhesionreceptor or acting as a signaling molecule.

Results

The ampA gene influences the migration of growing cells to folicacid

In nature Dictyostelium lives on the forest floor and feeds on bacteriawhich it locates by chemotaxis to folic acid present in bacteria. In thelaboratory Dictyostelium amoebae can be grown on agar plates inassociation with bacteria. Under these conditions, single Dictyosteliumcells grow by ingesting the bacteria by phagocytosis, clearing plaques in thebacterial lawn as cells migrate out radially to forage for more bacteria. Thesize of the plaques can reflect the rate of phagocytosis, the growth rate of thecells or the rate of migration of the cells out into the bacterial lawn. We havepreviously shown that plaques formed by ampA null cells aresignificantly smaller than those formed by wild type cells [25] and summarized in Table 1. By contrast theplaques formed by the AmpA overexpressing strain are significantly larger thanthe wild type plaques [25] and summarized in Table 1. The rate ofphagocytosis as measured by the uptake of latex beads by ampA null andoverexpressing cells is no different than wild type (Additional file 1). Additionally the rate of clearing of bacteria from asuspension culture is also no different between the 3 strains (data not shown).This indicates that the difference in plaque size is not likely due todifferences in the rates of phagocytosis of bacteria.
Table 1

Comparison of plaque size on rich broth and minimal media plates

Strain

Plaque area (mm2) on minimal medium plates

Plaque area (mm2) on rich broth plates

WT

1.41 +/−0. 17

0.94+/−0.08

KO

0.28 +/− 0.04*

0.020+/−0.002*

OE

2.33 +/− 0.28*

0.018+/−0.002*

Cells were plated for 4 days on LP (minimal media plates) withE.coli B/r and for 11 days on 1/2xHL5 plates onE.coli B/r (rich broth plates). The areas of between 30to 70 plaques per strain were determined on a minimum of 5 differentplates per strain. Experiments were repeated at least 3 times withsimilar results on different days. Absolute plaque size differs withdifferent batches of plates but the relative plaque size differencesbetween strains are highly reproducible. Errors are standard errorof the mean. * indicates difference is significant from Wt (p value< 0.001). There was no significant difference in plaque sizebetween KO and OE (p value = 0.26) on rich broth plates butsignificant differences between KO and OE on minimal media plates (pvalue < 0.001).

In order to determine if the difference in plaque size might reflect a differencein cell motility, the migration of single cells toward folic acid was monitored.Growing cells were placed on a thin layer of agar and folic acid was spotted amillimeter away. The migration of cells to the folic acid spot was imaged bytime lapse video microscopy [26]. The ampA null cells were largely unable to migrate towardfolic acid (Figure 1A and D). They mostly remainedstationary, occasionally reaching out a pseudopod, but almost never doing muchmore than rolling back and forth in the same spot (see movies in Additionalfiles 2 (Wt) and 3 (KO)).This caused a decrease in velocity and distance moved when compared to wild type(Figure 1A and D). The few knockout cells that areactually able to migrate do sense the chemoattractant and migrate towards it,albeit much more slowly than wild type (Figure 1A). Thelow chemotactic index (a measure of how directly a cell migrates to thechemoattractant defined in methods) for the ampA null cells reflectsthe failure of most of the cells to migrate rather than a loss of directionalitywhen they do migrate (Figure 1D). AmpA overexpressingcells move at a much increased velocity and cover much more distance than wildtype (Figure 1A and D). Several cells were measured thatmoved at speeds up to 30 um per minute but the average velocity was 16um/min as compared to 11 um/min for the wild type (Figure 1A and D & Movie in Additional file 4). Both Wt and AmpA overexpressing cells showed a similar ability tomigrate directionally towards the folic acid as indicated by the chemotacticindex.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig1_HTML.jpg
Figure 1

ampA null cells are defective migrating on top ofagar; overexpressing cells move very rapidly. A) Chemotaxisplots of individual cells in a representative field. Arrows indicate thelocation of the folic acid source. Note scale difference on the plot ofampA knockout. B) Morphology of cells migrating ontop of agar. Black arrows indicate pseudopods; white arrows, uropods.Time is in seconds. Scale bars are 20 um. C) Difference plotscreated by overlaying the cell outline in frame 1 with the cell outlinein frame 2. Green represents areas of protrusion and red representsareas of retractions. D) Quantification of cell migration. Dataare the averages +/− the standard error of the mean. Differenceswere checked using a 2 tailed paired Student’s t-test with p <0.05 indicating a significant difference (*). Data are compilations of40–100 cells tracked in 6 different experiments. C.I. ChemotacticIndex (see Methods). The distance migrated (total) is in 5 minutes.Productive distance is the Euclidian distance from the start of imagingto the final time point. Directionality is the ratio of productive tototal distance and is a measure of how progressive the movement is.E) Differences in actin organization in ampA mutantcells migrating to folic acid on top of agar. Live cells carry a plasmidcontaining the ABD120-GFP fusion protein (a marker for F-actin). Wt andAmpA overexpressing cells contain the blasticidin resistant version ofthe plasmid and ampA null cells carry the G418 version of theplasmid. The direction of migration is toward the top of the image.Scale bar is 20 um.Time is in seconds.

In comparing morphologies, wild type cells have a true pseudopod and uropod(Figure 1B). Knock out cells produce fewer pseudopods(Figure 1B). The pseudopods that the cells do extend aremore rounded and not at all elongated as in wild type. In contrast, theoverexpressing cells form multiple pseudopods, statistically more than wildtype, and the cells are also much more elongated, as can be seen in theroundness value (Figure 1D). Roundness is the ratiobetween the width and the length of the cells. Perfectly round cells have aroundness value of 1 or 100%. Figure 1C illustrates thedifferences in protrusion and retraction of pseudopods. The protrusions areillustrated in green and retractions in red. Knock out cells form very smallprotrusions and retractions which use very little of their cell mass. Incontrast, overexpressing cells use most of their cell mass when formingprotrusions (Figure 1C).

AmpA regulates the level of actin polymerization in growing cells

The differences in pseudopod protrusion suggested the possibility that actinpolymerization could be influenced by AmpA. In order to analyze the actincytoskeleton, growing cells were stained with fluorescently labeled phalloidinand DNAse I to detect polymerized F-actin and unpolymerized globular actin(G-actin) respectively (Figure 2A, zoomed images ofrepresentative individual cells and Additional file 5Aand 5B for whole fields of cells). AmpA nullcells clearly contain significantly less polymerized F-actin than do wild typecells. By contrast, the overexpressing cells polymerize more actin than do wildtype. Quantification of the images indicates that ampA null cells haveabout 3x less F-actin than wild type while AmpA overexpressers have about 2xmore F-actin than wild type (Figure 2B). In order toconfirm that there was a difference in F-actin levels as a function ofampA expression, the amount of phalloidin binding to cell extractswas also measured (Figure 2C). This more accurate methodindicates that ampA null cells have 2.5x less F-actin than wild typewhile AmpA overexpressers have 1.6x more F-actin. In order to determine if thedifference in F-actin level is due to actin polymerization rather than actinprotein synthesis, the total amount of actin protein in the 3 cell lines wascompared in two different ways (Figure 3A, B, and C).First, equal numbers of cells were harvested and subjected to polyacrylamide gelelectrophoresis and stained with Coomassie blue. The amount of protein loaded onthe gels was determined to be in a linear range for the actin protein band. Therelative amount of actin protein was quantified. In order to control fordifferences in loading, a ratio of actin protein to a reference band wasdetermined. These ratios were identical for all three cell lines indicating thatthe same amount of total actin protein was present (Figure 3A and B). This result was confirmed by western blots which alsoshowed no significant difference in the amount of total actin protein in the 3cell lines, indicating that AmpA controls the levels of actin polymerization ingrowing cells, not the amount of actin protein (Figure 3C).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig2_HTML.jpg
Figure 2

AmpA influences the level of polymerized F actin. A) Wild type,amp A knockout (KO) and overexpresser (OE) cells werestained with Alexa 488-phalloidin to detect F-actin (green) and TRITClabeled DNAse I to detect G-actin (red). Imaging conditions wereoptimized for levels of phalloidin staining (see Methods). The fields ofcells from which the representative individual cells were excised are inAdditional file 5. The images are 3Dreconstructions from a confocal z series. Scale bar is 20 um. Thefluorescent F-actin images were all equally enhanced to more clearly seethe F-actin in the ampA knockout. B) Fields of Wt, KOand OE cells stained with Alexa 488 phalloidin shown in Additional file5 were quantified (see Methods). Theaverage pixel intensity per cell, cell surface area and pixelintensity/um2 are shown. Significance was determined by atwo-tailed paired Student’s t-test with a p value < 0.05indicated as significantly different from Wild type. 15 to 20 cells perstrain were quantified per experiment. The staining experiment wasrepeated 6 different times with cells grown on different days. C)The amount of Alexa 488-phalloidin bound to cells was determined (seeMethods). Results are averages of 3 different experiments with datapoints in triplicate. Error bars are standard error of the mean.

https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig3_HTML.jpg
Figure 3

AmpA does not change the amount of total actin protein in the cells.A) Polyacrylamide gels were loaded with total protein from 1 x105 cells per lane and stained with Coomassie. B)The amount of protein loaded was determined to give a linear rangesignal when scanned on a densitometer. To control for protein loadingdifferences the ratio of intensity of the F-actin band to a referenceband was determined. C) Western blot of total protein using ananti-actin antibody. 1 x 105 cells were loaded per lane. Incontrol experiments this amount of protein gave antibody staining foractin which was linearly dependent on the amount of protein loaded.

In order to observe the effects of the ampA mutations on the actincytoskeleton in live cells, Wt, ampA null and AmpA overexpressing cellswere transfected with a plasmid, GFP-filABD, which contains the actin bindingdomain of the ABD120 protein fused to GFP [27, 28]. While migrating ampA null cells are more rounded, theyclearly show actin polymerizing directionally in polarized, pseudopod and uropodlike structures although they are not as large and extended as seen with Wt orAmpA overexpressing cells (Figure 1E). They do not showthe pseudopod splitting that seems more prevalent in growing cells as theymigrate to folic acid. By contrast, the AmpA overexpressing cells not only showmore pseudopod splitting but they also show actin polymerized strongly aroundmost of the entire cell cortex. The Wt and AmpA overexpressing cells carry aGFP-filABD plasmid that contains a blastocidin resistance cassette. TheampA null cells had to be transformed with a GFP-filABD plasmidthat carried a G418 resistance marker that is usually present at much highercopy numbers. The F-actin level in the knockout cells was too low for detectionwhen the blasocidin cassette was used as a selectable marker. Thus it is notpossible to compare differences in actin levels in this image, only actindistribution and dynamics.

AmpA influences cell migration in an environment dependent manner

Loss of AmpA clearly reduces actin polymerization and cell migration, whileoverexpressing AmpA results in rapid migration and excessive actinpolymerization. The differences in cell migration are clearly consistent withthe differences observed in plaque size that we had reported [25 and summarizedin Table 1. When analyzing plaque morphology one normallyuses a low nutrient agar (minimal media plates) that reduces the density of thebacterial lawn and allows plaques to spread. It is under these conditions thatAmpA overexpressing strains make much larger than normal plaques. However if onewants to screen large numbers of Dictyostelium plaques on bacterialplates, a higher nutrient agar is used and the bacterial lawn that forms isdenser and the plaques are much smaller [29]. Surprisingly under these conditions AmpA overexpressing cells formplaques that are much smaller than wild type and are about the same size asthose formed by the ampA null cells (Table 1 andAdditional file 6B insets). In order to betterunderstand the role of AmpA in influencing plaque size in high density lawns,cells at the plaque periphery were imaged at high magnification from underneaththe agar plates and the migrations of individual cells that could bedistinguished at the plaque periphery were tracked (Additional file 6A and B). Increasing the density of the lawn of bacteriaappears to inhibit the ability of AmpA overexpressing cells to penetrate thebacterial lawn. Analysis of the centroid tracks of individual cells at theplaque periphery indicates that both wild type and ampA null cells movedirectly perpendicular to the edge of the plaque, but, surprisingly, theoverexpressing cells migrate circumferentially around the plaque (Additionalfile 6B). The yellow lines mark the tracks ofindividual cells over 30 minutes. The overexpressing cells travel nearly twiceas fast as the wild type cells and cover more distance even though it is in acircumferential direction (Additional file 6A and B).By traveling circumferentially around the plaque the overexpressing cells avoidthe problem of penetrating into the dense lawn of bacteria. The ampAnull cells, by contrast, cover about the same total distance as the wild typecells but they cover significantly less productive distance (Additional file6A). The productive distance moved by theampA null cells is only about 40% of the total distance migrated,indicating that most of the movement of the null cells is rolling back and forthrather than progressively moving out into the bacterial lawn (Additional file6A). Regardless of the density of the bacteriallawn, both wild type and overexpressing cells still migrate efficiently; whatdiffers is their direction of travel. The smaller plaques of the overexpressingstrains under rich broth conditions are clearly a result of the failure of thecells to enter the bacterial lawn while the small plaque size of theampA null cells is the result of multiple reversals in direction sothat the cells cover less productive distance. This raises the question ofwhether over expression of AmpA results in a reduction of substrate adhesion.Such a defect might permit faster migration but prevent the cells from beingable to adhere strongly enough to the substrate to be able to exert the force tomigrate through the dense lawn of bacteria.

AmpA influences cell-substrate adhesion

In order to address the question of whether the differences in migration detailedabove were due to an effect of AmpA on cell substrate adhesion, the relativeability of ampA null and AmpA overexpressing cells to adhere to asubstrate was determined. The cells were allowed to adhere to culture dishesovernight. They were then shaken at increasing shaker speeds and the percentageof cells that remain attached after 45 minutes at each speed was determined(Figure 4A). At 50 rotations per min (rpms) 80% of theampA null cells remain attached to the substrate, while only 50% ofWt cells remain attached. By contrast, less than 30% of the AmpA overexpressingcells are still adhering to the substrate. Thus, ampA knockout cellsare clearly more adherent than wild type cells, while the AmpA overexpressingcells have significantly decreased adhesion. Reflection imaging was used todetermine the percent of the cell area that was in contact with the substrate.For wildtype cells growing on glass cover slips about 50% of the cell surfacearea was in contact with the substrate but for AmpA overexpressing cells farless, 34%, was in contact with the substrate. For ampA null cells, moreof the cell surface area, 62%, was in contact with the substrate than for wildtype cells (Figure 4B top row of table (on glass);transmission and reflection images in Additional file 7A).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig4_HTML.jpg
Figure 4

AmpA influences cell substrate adhesion and substrate contact area.A) AmpA influences cell substrate adhesion. Cells grown on petridishes were shaken at increasing shaker speeds, RPM (rotations perminute) for 45 minutes and the percent of cells remaining on the dishwas determined. B) AmpA influences the % of the cell surface incontact with the substrate. To determine the percentage of the cell incontact with the substrate cells were imaged using transmitted light andin reflection mode to identify the area of the cell in contact with thesubstrate (Additional file 7 for raw data).The area of the cell and the area of the contact sites were determinedand the contact sites were expressed as a % of the total area of thecell. The number of cells imaged was 65 to 125 for cells sitting onglass and 50 to 95 for cells migrating under agar. Results are averagesfrom two different experiments preformed on different days. Error barsare the standard error of the mean. * indicates a significant differencewith a P value < 0.05 using a two tailed paired Student’st-test.

Migration under agar rescues the motility defect of ampA null cellsand reduces the rapid migration of AmpA overexpressing cells

Since AmpA overexpressing cells appear to have trouble penetrating a lawn ofdense bacteria and show less adhesion to the substrate, we tested the ability ofAmpA mutant cells to migrate in an environment where they have to migrate underagar, which requires more force [30]. Cells were placed in a well in a thin layer of agar on a glass coverslip about 1mm from a well containing folic acid. Over time the cells slip underthe agar and migrate on the glass cover slip towards the folic acid. In thisenvironment cells have a layer of agar on top of them to which they can adhereand form contacts and they migrate on a less deformable and less adhesive glasscover slip. Under these conditions the ampA knockout cells no longerhave any migration defect (Figure 5A and D and movies inAdditional files 8 (Wt) and 9 (KO). AmpA null cells actually move significantlybetter than wild type cells and even better than overexpressing cells underthese conditions. Their velocity increased significantly over wild type reachingan average of 13 um/min (Compare Figure 1D with5D). The distance traveled also increasedsignificantly compared with wild type. In contrast, the AmpA overexpressingcells appear to revert to the wild type phenotype (Movie in Additional file10). There is no significant difference betweenwild type and overexpressing cells in any of the migration parameters measured(Figure 5A and D).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig5_HTML.jpg
Figure 5

AmpA null cells migrate better than wild type underagar; overexpressing cells show reduced migration. Cells wereallowed to migrate to folic acid under agar as described in methods.Images were acquired every 10 seconds for 5 min. A) Chemotacticplots are a representative field. Arrows indicate the location of thefolic acid source. B) Morphological differences between the celltypes under agar. Black arrows represent pseudopods; white arrowsindicate uropods. Time is in seconds. Scale bar is 20 um. C)Difference plots were created by overlaying the outline of a cell inframe 1 with its outline in frame 2. Green represents areas ofprotrusion and red represents areas of retractions. D)Quantification of migration under agar on glass. The data are theaverages +/− the standard error of the mean. Differences werechecked for significance (*) using a 2 tailed paired Student’st-test, p < 0.05 was deemed significant. Data are the compilations of90–120 cells tracked in 6 experiments. The distance migrated is in5 minutes. E) Migrating under agar on glass ampAknockout cells form true pseudopods and uropods. Live cells carrying theABD-GFP plasmid were placed in a well cut in 0.8% agar opposite a wellcontaining 0.5 mM folic acid. Cells were allowed to sense the gradientfor 4–5 hours before imaging on a Leica SP5 confocal microscope.Time is in seconds. Scale bar is 10 um. The direction of migrationis to the top of the image. Wt and overexpressing cells contain theblasticidin resistant version of the plasmid and ampA nullcells carry the G418 version of the plasmid.

Migration under agar on glass also produces significant changes in morphology andsubstrate contact. Knockout cells under agar on glass now have true pseudopodsand uropods (Figure 5B and C) and are more elongated(Figure 5D). This is particularly apparent when onecompares the roundness value of 72% for the ampA null cells migratingon top of agar with the roundness value 41% when migrating on glass under agar(Figure 1D vs 5D). Additionally, thenumber of pseudopods that knockout cells extend is significantly greater thanwild type. These differences in the morphology of the ampA null cellsmigrating on glass under agar are also apparent when one observes the actincytoskeleton in live migrating cells under agar (Figure 5E). The ampA null cells migrating under agar show cleardynamic pseudopods that appear to split frequently. For the AmpA overexpressingcells, actin remains polymerized around the entire cell cortex (Figure 5E) although difference plots show less pseudopod extensionand retraction than was seen when they migrated on top of agar (Figure 5C).

The difference in migration behavior of ampA mutant cells under thesedifferent environmental conditions raises the question of whether either thedifference in the substrate or the presence of agar overlaying the cells altersthe contact of the cells with the substrate. Reflection imaging was used tocompare the percentage of the ventral cell surface in contact with the coverslip in the cells migrating under agar (Figure 4B bottomrow of Table (under agar); transmission and reflection images in Additional file7B). The wild type cells show relatively the samepercentage of the cell area in contact with the substrate in both conditions(53% sitting on glass vs 58% migrating under agar). By contrast theampA mutant strains both show significant changes in substratecontact area under the two different environmental conditions. The AmpAoverexpressers show a significant increase in % of surface area in contact withthe substrate when migrating under agar on glass than when sitting on top ofglass (34% sitting on glass and 61% migrating under agar). The ampAknockouts show significantly less of their surface in contact with the substratewhen migrating under agar than when sitting on glass (49% in contact whenmigrating under agar vs 62% sitting on glass in media). Migration at anair-water interface on top of agar represents a very different environment thanmigrating under agar on a glass cover slip. In order to test whether thesubstrate influences the rate of migration of the cells, we compared two moresimilar conditions; migration under agar on a glass cover slip with migrationunder agar on a plastic Petri dish substrate.

AmpA overexpressing cells migrate more rapidly under agar on plastic thanthey do on glass and ampA null cells migrate more poorly

Cells were induced to migrate under agar as before but on plastic cell culturedishes rather than glass cover slips. Under these conditions ampA nullcells now migrate identically to the wild type, moving with speeds and distancesthat are the same as wild type rather than faster as they did on glass underagar (Table 2). Wild type cells slowed a little bit from10.3 um/min to 8.3 um/min but knockout cells slowed much more; from 13.6 um/minon glass under agar to 8.1 um/min on plastic. This result is statisticallysignificant with a p value of < 0.005. Knockout cells migrate quite well,however, so the phenotype seen when migrating on top of agar is still rescuedwhen migrating under agar on plastic but they do not migrate faster like they dowhen the substrate is glass. The biggest change is seen with the AmpAoverexpresser. While knockout and wild type cells slowed down relative to theirrates on glass, overexpressing cells actually increased their velocitysignificantly on plastic by about 20% from migration over glass. It is alsointeresting to note that while overexpressing cells moved faster on plastic thenglass, these rates are still much slower, by about 40%, than their rates on topof agar. Thus the amount of AmpA clearly influences cell migration in asubstrate and environment dependent manner. Excess AmpA clearly provides anadvantage on soft substrates like agar enabling cells to migrate more rapidly,while loss of AmpA favors cells migrating on hard surfaces like glass.
Table 2

The substratum plays a role in the effect of AmpA on cellmigration

Cell line

Total distance (um)

Productive distance (um)

Directionality

C.I.

Velocity (um/min)

Roundness (%)

Pseudopod number

Wt

41.2 +/− 1.6

28.2 +/− 1.2

0.7 +/− 0.02

0.5 +/−0.1

8.3 +/− 0.5

47 +/−3

1.44 +/− 0.03

KO

39 +/− 2

24.5 +/− 1.3

0.7 +/−0.02

0.5 +/−0.1

8.1 +/− 0.5

57+/−2*

1.72 +/− 0.03*

OE

61 +/− 3*

39.2 +/− 1.9*

0.7 +/− 0.03

0.5 +/−0.1

12.2 +/− 0.6*

64+/−2*

1.45 +/− 0.03

Cells were placed in wells cut in a thin layer of 0.8% agar in aplastic dish. Folic acid was placed in another well. The cells wereallowed to sense the gradient for 4–5 hours before imagingevery 10 seconds for 5 min. Data are the averages +/− thestandard error of the mean. * indicates significant difference fromwild type. Differences were checked for significance using a 2tailed Student’s t-test p<0.05. Data are the compilationsof 40–50 cells tracked over plastic under agar. The distancemigrated is in 5 minutes. Terms are defined in the legend to Figure1 and in methods. AmpA overexpressingcells move significantly farther and faster than wild type, buttheir directionality and chemotactic index are unchanged.AmpA knockout cells move in a statistically similarmanner to wild type and not faster as they did on the glasssubstrate.

AmpA protein is localized in punctuate membrane vesicles and in a perinuclearcompartment

In order to better understand the mechanism by which AmpA influences actinpolymerization, substrate adhesion, and cell migration, AmpA fusion proteinconstructs were generated in order to use immunofluorescence microscopy todetermine the location of AmpA in the cell. Strains were made that containedAmpA with a TAP Tag fused to its C-terminus (Additional file 11A) [31]. Two strains containing the AmpA-TAP fusion protein were created. Thefirst AmpA-TAP tag strain was created by electroporating the entire circularizedplasmid into wild type cells. This led to the AmpA-TAP tag fusion protein beingexpressed on an extrachromosomal plasmid and resulted in a strain that had anAmpA overexpresser phenotype. It made large plaques on bacterial lawns(Additional file 11C and D). Like the AmpAoverexpresser strains previously characterized it arrested development at moundstage (Additional file 11E, compare to AmpAoverexpresser strains in [19] Figure 10F and [21] Figure 3A). We call this strain AmpA-Taptag-OE, for overexpresser phenotype. The second strain was created byintroducing a linearized KpnI-NotI DNA fragment of the AmpA-Tap tag vector intowild type cells. This fragment contained only the ampA gene fused tothe Tap tag plus the blastocidin resistance cassette. While this fragment didnot integrate into the ampA gene and create a gene replacement, it didresult in a cell line that behaved as a wild type cell line, contained about 3xless AmpA-Tap tag protein that the stain with the overexpressing phenotype(Additional file 11B) and formed plaques on bacteriallawns that were not significantly different from the size of Wt plaques(Additional file 11C and D). Like Wt, this strainprogressed normally through development (Additional file 11E). We refer to it as AmpA-Tap tag-Wt.

We also constructed a second vector containing an AmpA fusion protein. This onehad the mRFP protein fused to the N terminus of the AmpA protein immediatelyafter the hydrophobic leader sequence (Additional file 12A) [32]. When this plasmid was introduced into wild type cells as a circularplasmid, the cells also displayed an AmpA overexpresser phenotype, making largeplaques on bacterial lawns and arresting development at mound stage (Additionalfile 12B, C and D). The fact that both overexpressingfusion protein vectors showed the typical AmpA overexpression phenotypeindicates that both the AmpA-tap tag and the mRFP-AmpA fusion proteins areactive and functional and can thus be used as probes to localize AmpA. Initiallocalization experiments were done with the AmpA-Tap tag constructs but laterbatches of anti-tap antibody were not suitable for immunofluorescence studies sothe mRFP-AmpA construct was used instead. Where possible, results are shown withboth constructs.

Both AmpA-Tap tag-OE and AmpA-Tap tag Wt cells and cells containing the mRFP-AmpAfusion protein construct were imaged using fluorescently labeled anti-tap tag oranti-RFP antibodies (Figure 6A showing the mRFP-AmpAconstruct and Additional file 13A showing AmpA-Taptag Wt and OE). AmpA protein was localized to a series of punctuate spotspresent throughout the cell and also in a perinuclear location which is evidentin Figure 6A where the nuclei are stained with DAPI. Allthree strains showed the same pattern of AmpA location indicating that neitherthe source of the fusion protein or the overexpressing phenotype appeared toinfluence the location. The punctuate spots are likely membrane bound vesiclesbecause cell fractionation studies show that AmpA is largely present in themembrane fraction (Figure 6B and Additional file 13B showing the AmpA-Tap tag construct). A small amountis found in the cytoplasm but since AmpA has a hydrophobic leader sequencecharacteristic of secreted proteins it is likely that this is due to rupture ofsome of the vesicles during fractionation.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig6_HTML.jpg
Figure 6

AmpA is found in vesicles and in the perinuclear region but not withF-actin. A) Wt control cells (top row) and cells carrying themRFP-AmpA fusion protein construct (bottom row) were immunostained withrat anti-RFP antibody and goat anti-rat antibody conjugated to AlexaFluor 488 (Invitrogen). The left panel is anti-RFP antibody staining(green), and the right panel shows overlays of the immunostaining onDAPI stained images (blue) to mark the nucleus and transmitted images.The scale bar is 9 um. B) Western blots of cellfractionations of mRFP-AmpA expressing cells. MW is molecular weightstandard. CY-Cytoplasm, Mem-Membrane, SN-Soluble Nuclear, CB-ChromatinBound, CS-Cytoskeletal. Controls for this fractionation are in [25]. C) AmpA does not colocalize with F-actin. Cells werefixed and stained for AmpA Tap tag and F-actin. Green: Alexa fluor 488phalloidin stain for F-actin; Red: AmpA Tap tag antibody. Representativeimages are single optical sections from a Z series. Scale bar is 5 um.An AmpA-Tap-Wt (top) and an AmpA-Tap-overexpressing strain (bottom) areshown.

AmpA does not colocalize with sites of actin polymerization but a portion ofthe AmpA protein is located in the Golgi and an ER derived compartment thatis perinuclear

Because of the strong affect AmpA has on actin polymerization, it is possiblethat vesicles containing AmpA localize to sites of actin polymerization orstrong actin staining. AmpA-TAP-tag labeled cell lines with both wild type andoverexpresser phenotypes were stained with phalloidin and the anti-tap tagantibody. Figure 6C shows representative optical sectionsfrom both of the AmpA TAP tag fusion protein containing cell lines. The opticalsections show that actin is present at the edges of the cell and that AmpA islocalized in punctate spots or vesicles throughout the cell, but there is notrue overlap between the two, other than by chance.

Since AmpA has a hydrophobic leader and must travel through the endoplasmicreticulum (ER), the hypothesis was that these punctuate spots were membranesfrom the ER or Golgi. To test this theory, AmpA-TAP tag cells were transformedwith a plasmid containing Calnexin-GFP. Calnexin is a Ca++ bindingprotein found in the ER [33]. AmpA-TAP does colocalize with calnexin but only in a perinuclearcompartment and not throughout the rest of the ER (Figure 7A). The average Pearson coefficient for localization throughout thewhole cell is 0.271 (out of a possible 1.0 for complete colocalization)indicating the partial nature of this colocalization.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig7_HTML.jpg
Figure 7

Colocalization of AmpA with calnexin, golvesin and p25. A) SomeAmpA is found in a perinuclear compartment and colocalizes there withthe ER marker calnexin. Top panels are Wt control cells that do notcontain the calnexin GFP or the AmpA tap tag fusion protein. The cellswere fixed, permeabilized and stained with rabbit anti-TAP antibody andgoat anti-rabbit antibody conjugated to FITC (red). The second rowpanels show AmpA tap tag cells containing calnexin GFP (green) fixed,permeabilized and stained with rabbit anti-TAP antibody and goatanti-rabbit antibody conjugated to FITC (red). Cells were incubated withDAPI to stain the nuclei (Blue). Arrows indicate areas of calnexin andAmpA tap tag colocalization in a perinuclear compartment. Scale bars are18 um for the field of cells in top row and 9 um for thezoomed images in the second row. Images are single optical sections froma confocal z-series. B) AmpA is found in the Golgi colocalizingwith N-golvesin. mRFP-AmpA cells were transformed with a plasmidcarrying N-Golvesin-GFP (Golgi marker-green) incubated, fixed andstained with rat anti-RFP antibody followed by Alexa goat anti-ratantibody (red). Arrow indicates the area of colocalization in the Golgi.DAPI (blue) stains the nucleus. Images are single optical sections froma z-series. Scale bar is 11um. C) AmpA colocalizes with p25, arecycling endosome marker in a perinuclear compartment. mRFP-AmpA cellswere stained with rat anti-RFP (green) and mouse anti-p25 (red). DAPI(blue) stains the nucleus. Arrow indicates area of p25 and AmpAcolocalization. Images are single optical sections from a z-series.Scale bar is 11 um.

N-golvesin GFP is a fusion protein that is found distributed in the membranes ofthe Golgi and Golgi derived vesicles including endosomes and contractilevacuoles [34]. mRFP-AmpA cells were transformed with the N-golvesin-GFP containingplasmid. AmpA was seen to colocalize with N-golvesin predominantly in the Golgiadjacent to the nucleus (Figure 7B). It also showed somecolocalization with AmpA in vesicles near the perimeter of the cell but therewere other golvesin labeled vesicles that did not contain AmpA (Figure 7B). The Pearson coefficient for this localizationthroughout the whole cell is 0.23 indicating the partial nature of thecolocalization sites. Thus AmpA is in the Golgi and in some Golgi derivedvesicles near the cell periphery.

AmpA colocalizes with the endosomal recycling marker p25 in a perinuclearcompartment

Since AmpA is found in a perinuclear compartment and in vesicles, we looked tosee if it was associated with other endosomal markers. The protein p25 has beenused to identify a perinuclear slow endosomal recycling compartment [35]. AmpA-mRFP colocalizes with p25 in the perinuclear region (Figure7C). The average Pearson coefficient is 0.216indicative of the colocalization of these proteins in some compartments but notall compartments. This raises the question of whether AmpA colocalizes with p25because it plays a role in membrane recycling or because AmpA itself is recycledfrom the membrane.

AmpA is localized at low levels on the cell periphery and recycled viaendocytosis

Since AmpA is found in a cell compartment consistent with a role in membraneprotein recycling, it is possible that AmpA would be found on the plasmamembrane. In standard fixation procedures we have not clearly seen AmpA on themembrane but the association could be lost due to the fixation orpermeabilization. To determine if AmpA is on the membrane, live AmpA mRFP cellswere incubated with DiI membrane stain and then with anti mRFP primary antibodyeither at room temperature (Figure 8A) or at 4°C(Figure 8B). The cells were then washed and incubated withgoat anti rabbit secondary antibody conjugated to FITC. The figures representoptical sections from a z-series and indicate that under these conditions wherelive cells were used, AmpA colocalizes with DiI on the membrane. These resultssuggest that AmpA is on the plasma membrane but, when cells are permeabilizedprior to staining, this fraction of AmpA is lost, perhaps indicating a weakinteraction. Although these cells were never permeabilized, there is a fractionof labeled intra-cellular AmpA which is likely the result of endocytosis of theextracellular cellular AmpA plus bound antibodies (Figure 8A). The internalized AmpA is in the same locations as the DiI whichenters the live cells by endocytosis (Figure 8A). Theinternal fraction of AmpA staining is largely missing in Figure 8B where the live cells were maintained at 4°C to preventendocytosis.
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig8_HTML.jpg
Figure 8

Some AmpA protein is found extracellularly on the cell surface. A)Live cells were incubated with the membrane stain DiI and with ratanti-RFP antibody in the dark at room temperature. Cells were washed andthen incubated for 1 hour with goat anti-rat antibody conjugated toAlexa-Fluor 488, then washed and fixed but never permeabilized. Imagesrepresent single optical sections of a z-series. Arrows indicatecolocalization of mRFP-AmpA with DiI at the cell periphery. Scale bar is13 um in the field images (top row) and 5 um in the zoom of asingle cell (bottom row). B and C) AmpA on the cellsurface is endocytosed and traffics to a perinuclear endosomal recyclingcompartment. Live cells were incubated 4°C with rat anti-RFPantibody. B) Some of the coverslips were maintained at 4°Cto prevent endocytosis, washed to remove excess anti-mRFP antibody,fixed and then permeabilized and labeled with goat anti-rabbit secondantibody. Slices of cells from a Z series to show that the labeling islargely on the outside of the cell and not in the interior. Scale bar is10 um C) Cells on the other coverslips (panels labeled 22degrees) were washed to remove excess anti-mRFP antibody, then incubatedat room temperature for 15 min to allow endocytosis of the antibodybound mRFP-AmpA and then fixed and permeabilized to allow labeling withsecond antibody to detect anti-RFP antibody that had been internalizedwith the AmpA. The image is a slice from a Z series. The scale bar is10 um.

In order to determine if AmpA is being endocytosed, live AmpA-mRFP cells wereincubated with primary anti mRFP antibody at 4o for 10 minutes [35]. Some of the live cells were immediately incubated with secondaryantibody and imaged (Figure 8B). These live cells showedmRFP-AmpA on the cell surface. A second set of the live cells were thenincubated at room temperature for 15 minutes to allow time for the AmpA-mRFPplus antibody to be endocytosed. These cells were then washed and fixed withformaldehyde. The cells were then permeabilized to allow entry of the secondaryantibody. This led to high intra-cellular staining of mRFP-AmpA, which couldonly happen if AmpA had been endocytosed by the live cells while bound to theprimary antibody (Figure 8B and C). Some of this stainingis located in the perinuclear area suggesting that endocytosed AmpA may travelto the perinuclear slow recycling complex where it was observed to colocalizewith p25 (Figure 7C).

AmpA overexpression increases endocytosis

Actin plays an important role in endocytosis and the fact that AmpA appears tocycle from the cell surface to interior vesicles and a perinuclear site raisesthe question of whether AmpA is passively endocytosed or whether it influencesmacropinocytosis. In order to determine if there was a change in levels ofmacropinoctyosis in AmpA mutants, the rate of FITC dextran uptake was measured.AmpA over expressing cells endocytose dextran at a more rapid rate than do thewild type cells (Figure 9A). The rate of endocytosis forthe ampA knockout was not reproducibly different than wild typealthough in some experiments the rate does not plateau, in all other measures ofendocytosis, such as time lapse videos or imaging of the amount of dextran inthe cells (data not shown), the ampA null cells were similar to wildtype. The AmpA overexpressing strain (OE1) makes about 3X the wild type level ofAmpA protein [19]. A second AmpA overexpressing strain (OE2) that makes about 6X thewild type level of AmpA was created by selecting for an AmpA overexpresser thatcould grow in 10x the normal amount of G418 [19]. The rate of endocytosis by the OE2 AmpA overexpresser was even morerapid than that of the OE1strain. The OE1 strain endocytosed dextran at a rateof 5 ug dextran per 106 cells per hour while the OE2 strainendocytosed the dextran at 7 ug per 106 cells per hour compared tothe wild type rate of 3.5 ug dextran per 106 cells per hour. Thus,while AmpA is not essential for normal rates of endocytosis, overexpressing AmpAprotein significantly increases the rate of endocytosis in a dose dependentmanner. The rate of exocytosis, by contrast, was similar for all cell linestested (Figure 9B).
https://static-content.springer.com/image/art%3A10.1186%2F1471-2121-13-29/MediaObjects/12860_2012_Article_644_Fig9_HTML.jpg
Figure 9

AmpA overexpression increases the rate of endocytosis but notexocytosis. A) FITC dextran was added to cells in shakingculture to a final concentration of 2 mg/ml. Aliquots were taken everytwenty minutes and prepared as described in methods. Fluorescence wasread on a Bio-Rad fluorimeter. B) Cells in shaking culture wereincubated in FITC dextran as in A. They were then washed toremove extracellular FITC. Aliquots were taken every twenty minutes. Theamount of FITC dextran present at Time = 0 was labeled as 100% for eachcell type, and the FITC dextran remaining in the cell was taken as apercentage of the original amount. For A and B,error bars represent the standard error of the mean. The data representthe averages of a minimum of 5 separate determinations done on differentdays. C and D) Overexpression of ampA causes multipleendocytic cups to form repeatedly at the same site. C) Wt andD) AmpA overexpressing cells containing the blasticidinresistant ABD-GFP plasmid were placed in chambered cover slipsovernight. Images were taken every 20 seconds for 5 minutes. Theseimages are representative slices from the time courses. Calibration bar= 6 um. Images of additional AmpA overexpressing cells undergoingendocytosis are shown in Additional file 14.

In order to understand the mechanism by which overexpressing AmpA proteinincreases the rate of endocytosis, live cells containing the ABD-GFP plasmidwere imaged as they underwent endocytosis. The overexpressing cells showed avery unusual phenotype. They did not appear to make more endocytic cups butinstead a number of the cells extended multiple endocytic cups from exactly thesame point, one right after the other (Figure 9D versuswild type in Figure 9C and Additional file 14 for images of 2 additional AmpA overexpressing cellsand the movies in Additional files 15 (Wtendocytosis) and 16 and 17(AmpA overexpresser endocytosis)). In the wild type cells, the endocytic cupopens, engulfs the medium, and then retracts. At this point the polymerizedactin at the site of cup formation is removed (Figure 9Cand movie in Additional file 15). In a number of AmpAoverexpressing cells, the endocytic cup opens, engulfs, then partially retracts,then opens and engulfs again appearing to use the same nucleus of polymerizedactin to form the next endocytic cup (Figure 9D,Additional file 14 for 2 additional cells and themovies in Additional files 16 and 17). This repeated formation of endocytic cups at the same site isseen in 49% of the overexpressing cells (94 cells counted) but in only 8% of thewild type cells (98 cells counted). Other aspects of the endocytic process inthe AmpA overexpressing cells seem entirely normal. The acidification of theendosomes occurs normally (Additional file 18),indicating that the actin surrounding the early endosome is properlydepolymerized allowing the fusion of the early endosomes with the vesicle protonpumps.

When measuring endocytosis rates in the AmpA overexpressing cells, centrifugationof these cells prior to the assay led to a long delay before the cells were ableto take up the dextran. For this reason we determined endocytosis rates byadding dextran to the media. The sensitivity of the AmpA overexpressing cells toeither the cold or centrifugation itself led to the question of whether therewas a contractile vacuole defect in the AmpA overexpressing cells but this doesnot appear to be the case. The contractile vacuole network in the Wt,ampA null and over expressing cells appeared to be identical(Additional file 19).

Discussion

AmpA has effects on cell adhesion, cell migration, actin polymerization, andendocytosis. The question becomes how a protein not localized to sites of actinpolymerization can play a role in these diverse cytoskeleton associated events. Itis possible that AmpA acts as a signaling molecule that triggers these diverseevents. Another possibility is that AmpA is involved in endocytosis and plays a rolein membrane recycling. AmpA colocalizes with the p25 protein in the perinuclearregion. Not much is currently known about the p25 protein other than that it isinvolved in the endosomal recycling pathway [35]. The identification of this protein was the first time recyclingendosomes had been demonstrated in Dictyostelium.

Endosomal recycling has been extensively studied in mammalian cells. Some of the mostwell studied cases of recycling to the plasma membrane involve integrins. In orderfor migration to occur, integrins must be removed from the plasma membrane viaendocytosis and then recycled back to form new adhesions [36]. There is a complex pathway of interactions taking place in the earlyendosome to sort the proteins to be recycled from those that are being degraded [37]. There are at least two distinct portions of the early endosome, atubular compartment to which proteins to be recycled are targeted, and large vesiclelike compartments, where proteins targeted for degradation are stored [38, 39].

There are two types of endosomal recycling, slow recycling and fast recycling. Fastrecycling occurs when the tubules in the recycling endosomes pinch off and areimmediately reabsorbed into the plasma membrane [40, 41]. The slow recycling may be where AmpA functions. During this process, theproteins are targeted to the endosomal recycling complex (ERC) [42]. There are two potential reasons for the slow versus fast recycling. Thefirst is that the cell has tight regulation of the proteins on the plasma membrane.If the proteins are recycled too rapidly, it may negatively affect how the cellmigrates or growth factor signaling may be over stimulated. But there is another,recently discovered cellular reason for proteins to enter the ERC. Some proteinsneed to go back through the Golgi via retrograde transport [43, 44]. Once the proteins have gone back through the Golgi, they can nowre-enter the secretory pathway.

AmpA is localized in what Charette suggests is an endosomal recycling complex inDictyostelium[35]. AmpA also appears to be localized to a distinct portion of the ER and tothe Golgi. However, Charette did not see any colocalization of p25 with calnexin orgolvesin, a marker for the Golgi body [35]. Since AmpA does have some colocalization with the ER, it is possiblethat, after recycling, AmpA may be reprocessed through a portion of the ER and Golgiin order to be trafficked back to the plasma membrane.

By imaging live cells, it is seen that AmpA can be found on the extracellularsurface. We have demonstrated that AmpA can be endocytosed, or recycled, because itcan be extracellularly labeled in live cells with primary antibody and the antibodyis then brought into the cell. Taken together these results seem to indicate a rolefor AmpA as a signaling molecule on the cell surface, possibly controlling adhesionand stimulating actin polymerization. Since AmpA is never detected free in the mediain wild type cells yet can be detected on the cell surface in live cells, it ispossible that it interacts with a membrane receptor protein as it passes through theER, Golgi or secretory vesicles and is transiently presented on the extracellularface of the plasma membrane bound to its receptor. Possibly, AmpA functions on thecell surface to signal the down regulation of an adhesion protein by endocytosis.The presence of excessive AmpA functioning in this manner would result in a decreasein adhesion relative to wild type and the lack of AmpA could result in excessadhesion protein on the cell surface. However so far no such adhesion protein hasbeen identified.

Zanchi et al. have used a temperature sensitive mutant of the secA gene to explorethe relation between plasma membrane recycling and cell movement. The failure ofexocytosis to take place in these mutants at the restrictive temperature results ina net uptake of plasma membrane which is suggested to restrict pseudopodialexpansion [45]. It is possible that the role of AmpA in increasing endocytosis couldalter plasma membrane recycling in the opposite direction resulting in increasedpseudopod extension which could influence cell migration. However the ampAnull cells do not show any alteration in endocytosis that we can reproduciblydocument so an explanation centering on general membrane turnover seemsunlikely.

For cell migration it would appear that the effect of AmpA on substrate adhesion ismore important than its role in actin polymerization, since ampA null cellscan migrate as well as Wt cells under the right environmental conditions.Interestingly, wild type cells show far less variation in their migration rates as aresult of environmental conditions (11.1 um/min on top of agar and 10.3 um/min underagar on glass) than either AmpA overexpressers (16.0 um/min on top of agar vs 10.2um/min under agar on glass) or ampA null cells (5.0 um/min on top of agarvs 13.6 um/min under agar on glass). This suggests that there is an optimal level ofAmpA that enables a cell to migrate consistently through a variety of environmentsand that too much or too little AmpA, while advantageous in some environments, isdetrimental in others. Cells with an optimal amount of AmpA may not win the race onsome surfaces but they can get to the bacteria and feed when faced with a widevariety of surfaces.

The ampA null cells clearly are more adhesive not only to the substrateduring growth (Figure 3A) and development [19] but they are also more adhesive to each other [21]. When sitting at an air water interface on a cover slip the more adhesiveampA null cells have a much larger % of their surface area in contactwith the substrate and the less adhesive AmpA overexpressing cells show a veryreduced substrate contact area. This reverses when the cells are migrating underagar. The ampA null cells now show a reduction in substrate contact whilethe AmpA overexpressing cells show an increase. Interestingly the wild type cellsshow little difference in surface area contact under the two conditions (Figure4B). It is possible that with their increased adhesionlevels the ampA null cells adhere to the overlying agar as well as to thesubstrate, thereby spreading adhesion receptors over a greater portion of the cellsurface and thus reducing the area of contact with the underlying substrate. TheAmpA overexpressing cells may show more contact with the substrate under agar thanthey do at an air water interface not only because of the flattening effect of theagar but also because the agar layer on top of the cells may prevent aerialextension of the robust, overly actin rich pseudopods formed by these cells,directing them instead along the substrate and increasing the contact area. Anotherpossibility suggested in a review by Lammerman and Sixt [46] is that while surface anchoring is essential for migration in a 2Denvironment it is possibly dispensable in a 3D environment where cells are closelysurrounded by matrix materials. They base this suggestion on their studies in whichgenetic depletion of all 24 possible integrin heterodimers left unaltered themigration rate of neutrophils, dendritic cells and B cells in a 3D collagen gel. Inthis model the fact that the ampA null cells are overly adhesive may indeedrestrict their motility in a soft 2D environment up top of agar but under agar thisexcess adhesion may not come into play. Likewise the advantage of the reducedadhesion of the AmpA overexpressing cells in a soft 2D environment may be lost in a3D environment where dependence on adhesion receptors may be dispensable.

What is difficult to explain is the fact that AmpA both increases F-actin content andyet decreases adhesion and its absence has the opposite effect of increasingadhesion and decreasing F actin. This is the opposite of what would be expectedsince actin is a major component of cell adhesion. It is possible that AmpA acts asa signaling molecule on two different pathways and is required at a critical levelto keep the pathways in balance. A better understanding of this will require a moreextensive knowledge of the proteins that are involved in substrate adhesion duringmotility and their interaction with the actin cytoskeleton and the effects ofmembrane dynamics on their turnover. The results presented here suggest that AmpA isa player in these processes but its mechanism of action is unclear. AmpA likelyfunctions as a signaling molecule binding to another protein or receptor or acomplex of proteins. We have made many attempts to identify receptors or proteinsthat might interact with AmpA but the AmpA protein is 17% cysteine and has provedrefractory to all affinity chromatography or pull down approaches for identifying aninteracting protein. We have identified suppressors of AmpA overexpressingphenotypes and two of these have effects on endocytosis that influence cellmigration but neither mutant identifies a candidate for an AmpA receptor or AmpAregulated adhesion protein [25, 47]. It is possible that yeast 2 hybrid screens or identification of secondsite suppressors of ampA null phenotypes will eventually result in theidentification of the partners with which AmpA interacts and allow for a definitivemodel for AmpA function.

Conclusions

AmpA influences cell migration by influencing substrate adhesion and the area of cellsubstrate contact. Cells require an optimal level of Amp in order to migratesuccessfully over a wide variety of surfaces and environmental conditions. ExcessAmpA on soft deformable surfaces like agar at an air water interface results inrapid migration but if the cells encounter a thick layer of bacteria they cannotgenerate the force to invade it even with the excess actin that they polymerize.This is presumably because of the decreased substrate adhesion. By contrast, theabsence of AmpA in the null cells results in an almost complete failure of thesecells to be able to migrate on top of agar at an air water interface and in a lawnof bacteria they jig and roll back and forth and can only make very small plaques.In a 3D environment under agar and on a hard surface like glass the advantage ofexcess AmpA is lost and the knockout cells that lack AmpA are able to migrate betterthan wild type cells possibly because of their increased adhesion or possiblybecause a 3D environment has a reduced requirement for adhesion [46]. Even though they have a reduced level of F-actin, it is sufficient toallow them to migrate better than wild type cells in this 3D environment.

AmpA is associated with an ER derived perinuclear compartment, Golgi and Golgiderived vesicles; it is present on the extracellular surface and is endocytosed andfound in a perinuclear endocytic recycling compartment colocalized with p25, aprotein used to identify a slow recycling compartment [35]. In spite of its effects on F-actin levels and cell migration AmpA is notassociated with the actin cytoskeleton. Since AmpA does not have any transmembranedomains, only a hydrophobic leader sequence, it must require the partnership ofanother protein to be present on the cell surface. It is likely that as it transitsthrough the ER and Golgi to the cell surface where it binds to a receptor. Wepostulate that this receptor plays a role in cell-cell and cell-substrate adhesion.AmpA could potentially control the life time of this receptor on the cell surfaceand in this way influence adhesion and possibly actin polymerization. But it is alsopossible that AmpA is a secreted autocrine ligand that signals through a surfacereceptor. Obviously these models rests on identification of an AmpA receptor orinteracting protein which has so far not been identified. The SadA proteininfluences cell-substrate adhesion but is unlikely to be the AmpA receptor becauseSadA also influences phagocytosis and AmpA does not [14, 15]. We have made many attempts to isolate this receptor but, with 17%cysteine in the protein, AmpA is very difficult to work with biochemically and noneof the attempts to isolate interacting proteins have succeeded. We have used REMImutagenesis to identify second site suppressors of AmpA overexpressing cell lines byselecting for reduced cell migration. Interestingly, all of these mutants influencecell migration and two out of three of these mutants influence or are associatedwith endocytic processes [25, 47]. The best way to identify a potential AmpA receptor may be to use REMImutagenesis to isolate second site suppressors of the ampA null mutant.Until a receptor for AmpA can be identified it will not be possible to furtherdefine how an optimal level of AmpA influences both cell substrate adhesion andactin polymerization to maintain a constant rate of migration over a wide variety ofsubstrates.

Methods

Axenic Growth of Dictyostelium

Cell lines with the ampA gene knocked out or over expressed as well asmethods for growing cells are described by [19]. For cell lines containing the blasticidin resistance cassette (bsr)or the G418 resistance cassette, 10ug/ml blasticidin S hydrochloride or 9.6ug/ml G418 was included in the media respectively. Cells in late log phase (3-4× 106) were used in all experiments unless otherwise indicated.The ampA knockout and AmpA protein overexpressing cell lines areavailable from the Dictyostelium Stock Center(http://www.dictybase.org). An ampA null strain in whichthe blastocidin cassette has been removed by the lox-cre recombination system isdescribed [25, 48]. Cells were plated on LP agar plates (5 gm/liter Bactopeptone, 5gm/liter Lactose, 2% agar) on a lawn of E. coli B/r for single coloniesfor plaque formation assays. The plates were incubated in a moist chamber at22°C for 72 to 96 hours. In some experiments cells were plated on 1/2HL5plates instead of LP agar plates. These richer plates allow for a thickerbacterial lawn. Plaques on LP plates were imaged after 5 to 6 days while plaqueson 1/2HL5 plates were imaged after 11 days.

Generation of mRFP-AmpA and AmpA-Tap tag fusion protein plasmids

AmpA-Tap tag plasmid

The ampA gene from the Eco RI site at the start of the promoter tothe last amino acid codon (2.3Kb) was PCR amplified and cloned into themultiple cloning site between the Eco R1 and BamH1 sites of the pDDGal 16vector [49]. The 5 primer (Eco R1 site underlined) was5 CCGGAATTC TAAGAATATTATTATTATTATTA and the3 primer (Bam H1 site underlined) was5 CGCGGATCC TTGAGTTAAATTTTCACG. Thebeta-galactosidase sequence was removed by cutting with BamH1 and XhoI andreplaced with the Tap tag sequence which was amplified from pBS1479 [31] using a 5’ primer containing a BamH1 site (underlined)(5 AAGGGAACAAAAGCTGGAGGATCC ATG) and a3 primer containing an XhoI site (underlined)5 CTGACGCTCGAG TTAGGTTGACTTCCCCGCGGA to obtaina plasmid called pKL1. The pKL1 plasmid has a KpnI site immediately upstreamof the EcoR1 site at the start of the AmpA promoter. The AmpA3 downstream region from the AmpA termination codon toa site ~1000 base pairs downstream was PCR amplified. The5 primer containing a Bam H1 site (underlined) was5 AAGGGAACAAAAGCTGGAGGATCC ATG and the3 primer containing a Not I site (underlined) was5 TCAAGGATGAGCGGC CGC AATTCTCTATGGTCAACATTA.This PCR fragment was ligated into pLPBLP [48] at the BamH1 Not1 sites. This plasmid which contains the floxedblasticidin cassette was called pKL2. The 215 bp ampA terminatorsite was PCR amplified from the full length genomic clone of ampAin pGem3 using a 5 primer containing an Xho I site(underlined) 5 GGTTGTTGCCCATCTCGAG AAAATTTAACTCAAand a 3 primer containing a Hind III site (underlined)5 GCGGCCAAGCTT TTAATAGTGTGTTATTA. Instead ofsimply adding the restriction sites onto the 5 end of eachprimer, two bases were changed in the ampA sequence to create thesense primer and one base was changed to create the antisense primer. Thiswas done because it is hard to find segments with a high enough GC contentfor PCR. Therefore, two short primer binding sites with a relatively high GCcontent were chosen that flanked the ampA terminator region at the3 end of the gene. In the sense 5primer, GTCGTG was changed to CTCGAG to create an XhoI site, while in theantisense 3 primer AAGTTT was changed to AAGCTT to createa HindIII site. This PCR fragment was cloned into the pBluescript II vectorat the Hind III –XhoI site to obtain plasmid pKL3. The ampApromoter, coding region, and in frame fusion to the Tap tag was excised frompKL1 by Kpn I – XhoI and subcloned into the pKL3 plasmid at theKpnI-XhoI site so that the ampA terminator sequence was immediatelydownstream of the AmpA-Tap tag fusion protein gene. This generated plasmidpKL4. The KpnI-Hind III fragment from pKL4 was then subcloned into the KpnI–Hind III site of pKL3 to place the ampA-Tap tag–Terminator sequence adjacent to the blastocidin cassette and3 downstream ampA sequence in the AmpA-Taptag vector shown in Additional file 5.

The mRFP-AmpA plasmid was constructed so that the AmpA hydrophobic leadersequence (MLNKLILLLILSSCLVLSVKSE V – predicted cleavage siteunderlined) preceded the mRFP coding sequence [32] which was followed by the remainder of the ampA codingsequence starting with the amino acid “N” which immediatelyfollows the hydrophobic leader. A PCR copy of the ampA codingsequence starting at the amino acid (N) immediately following thehydrophobic leader and continuing 193 nucleotides downstream past the uniqueAge I restriction enzyme site in the ampA coding sequence wasgenerated. The 5 primer containing a BamH1 site(underlined) was 5 GCGCGGATCC AATGTTGATTGCTCCCTCGand the 3 primer containing a ClaI site (underlined) was5 CGCGATCGAT GGTTGGTGGGAGAGTACATGGA. This PCRfragment was cloned into the 339–3 mRFPmars-BsrH plasmid [32] to generate an in frame fusion of mRFP-mars to AmpA codingsequence distal to the hydrophobic leader (mRFP-mars-AmpA-C-terminal). This880 base pair DNA fragment was excised from the BsrH plasmid as aHindIII-ClaI fragment and subcloned into the HindIII –ClaI site of apBluescript plasmid (Stratagene) to generate pBlue1. A 1550 base pair PCRfragment was generated that included the 5 AmpA promotersequence starting upstream of the unique Bgl II site and ending at the lastamino acid of the AmpA hydrophobic leader sequence (V). The5 primer for this PCR product containing an Eco RIsite (underlined) was 5CGCGGAATTC ACAACTAATTGTAATACCTGCAATTG and the 3primer containing a Hind III site (underlined) was 5GCGCAAGCTT AACTTCACTTTTAACTGATAGTACC. This fragment was clonedinto the pBlue1 plasmid at the Eco RI –Hind III site to generatemRFP-AmpA-pBlue2. Next, the pBlue2 plasmid was cut with BglII and AgeI.These are unique restriction enzyme sites in the ampA promoter andcoding region respectively. Cutting at these sites excises the mRFP-AmpAconstruct from the pBlue2 vector. This BglII-AgeI fragment was cloned into afull length ampA Eco RI genomic DNA fragment in a pGem3 vector andreplaced the endogeneous BglII-AgeI DNA fragment with the BglII-AgeI DNAfragment that now contained the AmpA hydrophobic leader fused in frame tothe N-terminus of the mRFPmars coding sequence which is fused in frameN-terminal to the remainder of the AmpA coding sequence. Finally the floxedblastocidin cassette from the PLPBLP plasmid [48] was excised with PstI and XmaI and cloned into the PstI-XmaIrestriction sites in the multiple cloning site of the pGem3-mRFP-AmpA vector(Additional file 6).

Transformation of Dictyostelium

Plasmids containing GFP fused to ABD120 [28], Calnexin [33] or N-Golvesin [34] were acquired from the Dictyostelium Stock Center. Allplasmids were inserted into the Dictyostelium cells viaelectroporation [50].

Live Cell Microscopy of Transformed Strains

Cells were placed on chambered coverslips overnight in HL5 media for16–18 hours and imaged on a Leica SP5 confocal microscope. For timecourses, images were acquired every 5–10 seconds for 5 minutes. Alldata were analyzed using either the Volocity Program (Perkin Elmer) or ImageJ (NIH).

Endocytosis

Wild type Ax3, ampA knock out, and AmpA overexpressing cells weregrown to a density of approximately 3 × 106 cells/ml andassayed as in [51] with the exception that the media was supplemented with 2 mg/mlFITC dextran without centrifugation of the cells. One milliliter aliquotswere taken at times 0, 20, 40, 60 and 120 minutes. Fluorescence was read ona spectrofluorimeter (Bio-Rad) using a 488nm excitation filter and a 520nmemission filter. The fluorescence was compared against a standard curve andthe micrograms of FITC dextran that were endocytosed per 1 ×106 cells were determined.

Exocytosis

For exocytosis assays, the cells were grown to a density of 3 ×106 cells/ml. The growth medium was supplemented with 2 mg/mlFITC dextran and the cells were incubated for 3 hours. The cells were thencentrifuged and the media was replaced with unsupplemented HL5. Onemilliliter aliquots were taken at 0, 20, 40, 60, and 120 minutes. Thealiquots were washed once with HL5 and once with endocytosis wash buffer.The procedure then was as described above [51].

Phagocytosis

Phagocytosis was assayed by following the uptake of carboxylated fluorescentlatex beads (FITC#15702) from PolyScience, Warrenton Pa. (1 um in diameter)as described [52]. Fluorescence was determined using a BioRadspectrofluorimeter.

FM-64 staining

FM-64 Staining is described in [53]. Cells were imaged using a Leica SP5 confocal microscope.

Phalloidin binding

Phalloidin binding to quantify the amount of polymerized actin was carriedout according to [54]. Cells were grown to mid-log phase and 3 × 107cells were centrifuged and the pellet resuspended in 1 ml 20 mMK2KPO4. A 100 ul sample of cells was placed in 1ml fixing solution (3.7% formaldehyde, 10 mM PIPES, 0.1% TritonX-100, 20 mMK2KPO4, 5 mM EGTA, 2 mM MgCl2 and 250nM Alexa fluor 488-phalloidin (Molecular Probes) and incubated at roomtemperature for 1 hour. Cells were then centrifuged for 5 minutes at 2000rpm in a microcentrifuge and after one wash in 20 mMK2KPO4 the pellet was resuspended in 1ml methanoland vortexed briefly. Cell debris was removed by a brief centrifugation in amicrofuge and the FITC-fluorescence in the supernatant was determined usinga BioRad versafluor fluorometer with a 488 nm excitation filter and a 520 nmemission filter. Data points were taken in triplicates and the assaysrepeated 3 times on different days with different batches of cells.Nanomoles of phalloidin were determined by comparison to a knownconcentration standard curve assayed in parallel.

Cell adhesion assay

2 × 106 cells in 10 ml were placed on 60x15 mm plates (Sarstedt) and allowed to incubate overnight in a humid chamber. The following day, the cells were placed on a shaking platform at the indicated shaker speeds (rotations per minute, RPMs) for 45 minutes. The supernatant was then removed and the number of cells released from the plates was determined. Medium (10 ml) was then re-added to the plates which were scraped and the number of cells that had remained attached to the plate was assayed. The number of cells that remained attached was calculated as a percentage of total cells.

Reflection imaging to determine the percent of the cell surface incontact with the substrate

Cells were allowed to adhere in chambered cover slips overnight. Thefollowing day they were imaged on the SP5 Confocal microscope in bothtransmitted light mode and reflection mode. The argon laser was used and theexcitation wavelength was 488 nm for reflection imaging. This allowed thevisualization of the area of the cell in direct contact with the substrate.The images were imported into ImageJ and the ratio of the area of the cellin contact with the substrate to the total area of the cell wasdetermined.

Migration of growing cells on top of and under agar

Migration of cells under agar was according to [30] using 0.8% agar. The agar was formed either on chambered glasscover slips or on plastic dishes. Cells in HL5 were placed into wells cut inthe agar. Folic acid (0.5 mM) was added to a trough 5 mm awayfrom the trough containing the cells 1 hour prior to the addition of cellsto allow a gradient to form. Cells were imaged from underneath using a 40xobjective on a Leica SP5 scanning confocal microscope. Imaging was initiated3 to 5 hours after the addition of cells to the wells. Images were collectedat 10 second intervals for periods of 5 min.

Migration of cells on top of 1% agar in 20 mM NaKPO4 buffer was as describedby [26] except that a very thin layer of agar was spread on a chamberedcover slip. Cells were grown to mid log phase in axenic culture. Cells werecentrifuged and resuspended at a volume of 1 × 107 cells/ml.Ten microliters of cells were spotted 1 mm away from a 5 ul drop of0.5 mM folic acid. The folic acid was spotted on the agar 1 hr before thecells to allow diffusion of the folic acid through the agar. Imaging wasstarted 4 hours after the addition of cells. Cells were imaged fromunderneath with a 40x objective equipped with a correction collar on aninverted Leica SP5 confocal microscope. Because the thickness of the thinlayer of agar varies from dish to dish it was necessary to use the zoomfunction to get the very clearest images of cells on top of the agar. Thismeans that the magnification is not always identical from image to image inthese experiments but scale bars are imbedded in each image. Images werecaptured every 10 seconds for 5 min intervals. Image analysis was done usingthe Image J (NIH), Volocity (Perkin Elmer), Metamorph (Universal Imaging)and DIAS software (Solltec). Each image or video series was calibrated withits own scale bar.

Analysis of cell motility

Directionality is a measurement of how well cells move in a single directionand is determined by the ratio of productive distance to total distance.Total distance is the sum of how far the cell traveled. The productivedistance is how far the cell traveled from the point of origin over the timeof the measurement and is determined by the length of a straight line fromthe starting position to the ending position (Euclidian distance). Thechemotactic index is used to determine how well cells migrate to a source ofchemoattractant and is determined by taking the cosine of the angle betweena line that parallels the gradient and a line created between thecell’s end point and the cell’s starting point. A value of 1indicates the cell is moving directly up the gradient and a value of−1 indicates a cell is moving directly against the gradient. Roundnessis the ratio of the length to the width of the cell converted to a percent.100% is totally round.

Western Blotting

Strains were grown to log phase. 1 × 106 cells were harvestedby centrifugation and the pellet was resuspended in 30ul Laemmli samplebuffer [55]. Polyacrylamide gel electophoresis (PAGE) was performed under thestandard conditions [55]. For Western blots the proteins were transferred ontonitrocellulose using a Bio-Rad transfer apparatus. The transfer buffer wascontinuous buffer (0.292% glycine, 0.58% Tris, 0.0376% SDS, 20% MeOH). Thenitrocellulose was blocked overnight with 2.5% non-fat dry milk in TBST(10 mM Tris–HCl 150 mM NaCl, 0.05% Tween 20). The blot wasthen probed with either the anti-actin antibody (1:1000 dilution 224-236-1Hybridoma Bank) [56] or the anti-TAP antibody (1:1000, Open Biosystems). Initial lotsof anti-Tap antibody showed no cross reactivity with anyDictyostelium proteins and were suitable for immunofluorescenceimaging but subsequent lots contained cross reacting antibodies and wereonly suitable for western blots. Secondary antibodies were goat anti-mouseconjugated to alkaline phosphatase from Jackson Immunoresearch.

Immunofluorescence

Cells were grown to a high density (6 × 106 cells/ml). 100ulwere spotted onto a cover slip that had been placed in a petri dish withmoistened paper towels. The cells were allowed to adhere to the cover slipsfor 18 hours. The medium was removed and the cells were fixed with 4%formaldehyde in 20 mM Na2KPO4 buffer for 15minutes at room temperature. The cells were permeabilized in anhydrous MeOHwith 1% formaldehyde at −20°C for five minutes. The cells wereincubated with anti-tap (Open Biosystems) or anti-mRFP (Chromtek) antibodiesfor 2 hours followed by incubation for 2 hours with secondary antibodies(Invitrogen). The cover slips were washed 3x in PBS and mounted onmicroscope slides (Corning) coated with Prolong Gold Antifade Reagaent(Molecular Probes). For actin staining, cells were fixed in 0.3%gluteraldehyde and permeabilized with 0.1% TritonX-100 in PBS (pH 7.4)buffer. Where utilized, primary antibodies were applied followed byincubation with secondary antibodies. Alexa fluor 488-phalloidin (MolecularProbes) at a 1:500 dilution was included in the secondary incubation tolabel F-actin. Alexa fluor-594 conjugated deoxyribonuclease I (MolecularProbes) was added along with the phalloidin to label unpolymerizedG-actin.

For localization of mRFP-AmpA or AmpA-Tap tag to the plasma membrane, cellswere incubated for 10 minutes at 4o with the DiI membrane stain(Invitrogen) resuspended per the manufacturer's instructions. The cells werethen incubated for 1 hour at room temperature or at 4°C with ratanti-RFP primary antibody (Chromtek) or rabbit anti-tap antibody (OpenBiosystems). They were washed 3x with HL5 and then incubated in secondarygoat anti-rat or goat anti-rabbit antibodies conjugated to FITC. They wereagain washed with HL5 and then fixed with 3.7% formaldehyde in 20 mMNa2KPO4 buffer. They were washed and mounted oncover slips using Prolong Gold Antifade (Invitrogen).

Imaging of fixed cells was done on a Leica SP confocal microscope. For FITCand Alexa fluor 488-conjugated antibodies the Argon laser line 488 was usedfor excitation (20%) and an emission band width of 500-550 nm wasused. For 594 Alexa conjugated antibody imaging excitation was with the DPSSlaser line 561 (15%) and HeNe laser line 594 (30%) and emission was detectedat a range of 600 nm-767 nm. In DiI staining the DPSS laser line 561 nm(30%) was used for excitation and an emission range of 604-767 nm was used.For DAPI staining and nuclei visualization, the stain was excited with theDiode laser line 405 nm (8%) and emission was recorded at 430-477nm.

Quantitation of fluorescent images of F-actin staining in cells

Imaging of fluorescently labeled cells was done in pairs of Wt andampA nulls or AmpA overexpresser and Wt. In each pair the gainand laser power on the confocal microscope was set so that the most intensepixels of the pair (Wild type or Overexpresser) were set equal to 255 greyscale units so that the pair of fluorescent images would be in the linearrange (0 to 255 grey scale values) and could be quantified relative to eachother. Z series were collected and converted to an extended focus 3Dreconstruction and a 2D image of the 3D rendering was quantified in image J.The integrated pixel intensity per cell area in um2 wascalculated.

Microscopy and Image Analysis

Dictyostelium plaque formation on bacterial lawns was viewed underan Olympus dissecting scope. All plaque images were acquired at amagnification of 22x. For high magnification viewing of cells withinplaques, cells were imaged from underneath the petri dish using a Leica DMIRB microscope with a 40x objective with a correction collar. Images werecollected using a DC330 video camera (DAGE-MTI, Inc., Michigan City, IN,USA) and a frame grabber. Images were digitized, processed, and analyzedusing the Metamorph image processing system, (Universal Imaging, WestChester, PA, USA). Timelapse videos of cells migrating in plaques were takenat 1 to 2 minute intervals for 30 to 60 min. The microscope was refocusedafter collection of each image in the series. Cell migration was tracked andthe velocity determined using the centroid-tracking program in the Metamorphimage processing software. To track individual cells at the periphery ofplaques, each image in the video stack was enlarged 400x to clearly seeindividual cell outlines.

Authors’ information

DDB is associate professor at the University of Maryland, Baltimore County. This workconstituted partial completion of a Ph.D. thesis for EFN, JSK and HNC and an M.S.thesis for CLP. CLP is currently the manager of the Keith R. Porter Light andElectron Microscopy Facility at University of Maryland, Baltimore County. NB was anundergraduate research intern and a Meyerhoff Scholar at University of Maryland,Baltimore County.

Declarations

Acknowledgements

This work was supported by grants # RO1GM56690 from the National Institutes ofGeneral Medical Sciences, #MCB-0444883 and #BIR-9419949 from the NationalScience Foundation to DDB and MRI-0722569 from the NSF Instrumentation programto D.D.B. and Theresa Good. We thank Steve Charette and Pierre Cosson for thep25 antibody. We also thank Annette Muller-Taubenberger and the DictyosteliumStock center for the mRFP plasmid, and the Calnexin-GFP plasmid, Dave Knecht andthe Dictyostelium Stock center for the ABD120-GFP plasmid and Alan Kimmel forthe floxed blast cassette plasmid and the cre recombinase plasmid. We thank KateLannon, Stephanie Steiner and Julie Wolf for help with construction of theAmpA-Tap tag plasmid and the mRFP-AmpA plasmid and Juliette Russel for technicalassistance. Also, the Dictyostelium Stock center and Gunther Gerish supplied theGFP N-golvesin construct. The coronin and fimbrin antibodies developed byGunther Gerish were obtained from the Developmental Studies Hybridoma Bankdeveloped under the auspices of the NICHD and maintained by The University ofIowa, Department of Biology, Iowa City, IA 52242. We are grateful to the UMBCKeith R. Porter Imaging Facility for use of the microscopes and imagingsoftware. The tap tag construct was obtained from Bertrand Seraphin under aMaterial Transfer Agreement.

Authors’ Affiliations

(1)
Department of Biological Sciences, University of Maryland

References

  1. DiMilla PA, Stone JA, Quinn JA, Albelda SM, Lauffenburger DA: Maximal migration of human smooth muscle cells on fibronectin and type IVcollagen occurs at an intermediate attachment strength. J Cell Biol. 1993, 122 (3): 729-737. 10.1083/jcb.122.3.729.View ArticlePubMedGoogle Scholar
  2. Ke H, Parron VI, Reece J, Zhang JY, Akiyama SK, French JE: BCL2 inhibits cell adhesion, spreading, and motility by enhancing actinpolymerization. Cell Res. 2010, 20 (4): 458-469. 10.1038/cr.2010.21.PubMed CentralView ArticlePubMedGoogle Scholar
  3. Ponti A, Machacek M, Gupton SL, Waterman-Storer CM, Danuser G: Two distinct actin networks drive the protrusion of migrating cells. Science. 2004, 305 (5691): 1782-1786. 10.1126/science.1100533.View ArticlePubMedGoogle Scholar
  4. Le Clainche C, Carlier MF: Regulation of actin assembly associated with protrusion and adhesion in cellmigration. Physiol Rev. 2008, 88 (2): 489-513. 10.1152/physrev.00021.2007.View ArticlePubMedGoogle Scholar
  5. Giancotti FG, Ruoslahti E: Integrin signaling. Science. 1999, 285 (5430): 1028-1032. 10.1126/science.285.5430.1028.View ArticlePubMedGoogle Scholar
  6. DeMali KA, Barlow CA, Burridge K: Recruitment of the Arp2/3 complex to vinculin: coupling membrane protrusionto matrix adhesion. J Cell Biol. 2002, 159 (5): 881-891. 10.1083/jcb.200206043.PubMed CentralView ArticlePubMedGoogle Scholar
  7. Eichinger L, Pachebat JA, Glöckner G, Rajandream MA, Sucgang R, Berriman M, Song J, Olsen R, Szafranski K, Xu Q: The genome of the social amoeba Dictyostelium discoideum. Nature. 2005, 435 (7038): 43-57. 10.1038/nature03481.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Rivero F: Endocytosis and the actin cytoskeleton in Dictyostelium discoideum. Int Rev Cell Mol Biol. 2008, 267: 343-397.View ArticlePubMedGoogle Scholar
  9. Kessin R: Dictyostelium: Evolution, Cell Biology, and the Development ofMulticellularity. 2001, Cambridge, The United Kingdom: Cambridge University Press,View ArticleGoogle Scholar
  10. Loomis WF: The spatial pattern of cell-type differentiation in Dictyostelium. Dev Biol. 1982, 93 (2): 279-284. 10.1016/0012-1606(82)90117-8.View ArticlePubMedGoogle Scholar
  11. Jermyn KA, Williams JG: An analysis of culmination in Dictyostelium using prestalk and stalk-specificcell autonomous markers. Development. 1991, 111 (3): 779-787.PubMedGoogle Scholar
  12. Dormann D, Siegert F, Weijer CJ: Analysis of cell movement during the culmination phase of Dictyosteliumdevelopment. Development. 1996, 122 (3): 761-769.PubMedGoogle Scholar
  13. Sternfeld J: The anterior-like cells in Dictyostelium are required for the elevation ofthe spores during culmination. Dev Genes Evol. 1998, 208 (9): 487-494. 10.1007/s004270050207.View ArticlePubMedGoogle Scholar
  14. Cornillon S, Froquet R, Cosson P: Involvement of Sib proteins in the regulation of cellular adhesion inDictyostelium discoideum. Eukaryot Cell. 2008, 7 (9): 1600-1605. 10.1128/EC.00155-08.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Fey P, Stephens S, Titus MA, Chisholm RL: SadA, a novel adhesion receptor in Dictyostelium. J Cell Biol. 2002, 159 (6): 1109-1119. 10.1083/jcb.200206067.PubMed CentralView ArticlePubMedGoogle Scholar
  16. Bukharova T, Bukahrova T, Weijer G, Bosgraaf L, Dormann D, van Haastert PJ, Weijer CJ: Paxillin is required for cell-substrate adhesion, cell sorting and slugmigration during Dictyostelium development. J Cell Sci. 2005, 118 (Pt 18): 4295-4310.View ArticlePubMedGoogle Scholar
  17. Tsujioka M, Yoshida K, Inouye K: Talin B is required for force transmission in morphogenesis ofDictyostelium. EMBO J. 2004, 23 (11): 2216-2225. 10.1038/sj.emboj.7600238.PubMed CentralView ArticlePubMedGoogle Scholar
  18. Tsujioka M, Yoshida K, Nagasaki A, Yonemura S, Müller-Taubenberger A, Uyeda TQ: Overlapping functions of the two talin homologues in Dictyostelium. Eukaryot Cell. 2008, 7 (5): 906-916. 10.1128/EC.00464-07.PubMed CentralView ArticlePubMedGoogle Scholar
  19. Varney TR, Casademunt E, Ho HN, Petty C, Dolman J, Blumberg DD: A novel Dictyostelium gene encoding multiple repeats of adhesioninhibitor-like domains has effects on cell-cell and cell-substrateadhesion. Dev Biol. 2002, 243 (2): 226-248. 10.1006/dbio.2002.0569.View ArticlePubMedGoogle Scholar
  20. Varney TR, Ho H, Petty C, Blumberg DD: A novel disintegrin domain protein affects early cell type specification andpattern formation in Dictyostelium. Development. 2002, 129 (10): 2381-2389.PubMedGoogle Scholar
  21. Blumberg DD, Ho HN, Petty CL, Varney TR, Gandham S: AmpA, a modular protein containing disintegrin and ornatin domains, hasmultiple effects on cell adhesion and cell fate specification. J Muscle Res Cell Motil. 2002, 23 (7–8): 817-828.View ArticlePubMedGoogle Scholar
  22. Casademunt E, Varney TR, Dolman J, Petty C, Blumberg DD: A gene encoding a novel anti-adhesive protein is expressed in growing cellsand restricted to anterior-like cells during development ofDictyostelium. Differentiation. 2002, 70 (1): 23-35. 10.1046/j.1432-0436.2002.700103.x.View ArticlePubMedGoogle Scholar
  23. Abe T, Early A, Siegert F, Weijer C, Williams J: Patterns of cell movement within the Dictyostelium slug revealed by celltype-specific, surface labeling of living cells. Cell. 1994, 77 (5): 687-699. 10.1016/0092-8674(94)90053-1.View ArticlePubMedGoogle Scholar
  24. Manahan CL, Iglesias PA, Long Y, Devreotes PN: Chemoattractant signaling in dictyostelium discoideum. Annu Rev Cell Dev Biol. 2004, 20: 223-253. 10.1146/annurev.cellbio.20.011303.132633.View ArticlePubMedGoogle Scholar
  25. Kelsey JS, Fasman NM, Blumberg DD: Evidence of an evolutionarily conserved LMBR1 domain-containing protein thatassociates with endocytic cups and plays a role in cell migration inDictyostelium discoideum. Eukaryotic Cell. 2012, 11: 401-416. 10.1128/EC.05186-11.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Hadwiger JA, Srinivasan J: Folic acid stimulation of the Galpha4 G protein-mediated signal transductionpathway inhibits anterior prestalk cell development in Dictyostelium. Differentiation. 1999, 64 (4): 195-204.View ArticlePubMedGoogle Scholar
  27. Washington RW, Knecht DA: Actin binding domains direct actin-binding proteins to different cytoskeletallocations. BMC Cell Biology. 2008, 9: 10-10.1186/1471-2121-9-10. Feb 13,PubMed CentralView ArticlePubMedGoogle Scholar
  28. Pang KM, Lee E, Knecht DA: Use of a fusion protein between GFP and an actin-binding domain to visualizetransient filamentous-actin structures. Curr Biol. 1998, 8 (7): 405-408. 10.1016/S0960-9822(98)70159-9.View ArticlePubMedGoogle Scholar
  29. Sussman M: Cultivation and synchronous morphogenesis of Dictyostelium under controlledexperimental conditions. Methods Cell Biol. 1987, 28: 9-29.View ArticlePubMedGoogle Scholar
  30. Laevsky G, Knecht DA: Under-agarose folate chemotaxis of Dictyostelium discoideum amoebae inpermissive and mechanically inhibited conditions. Biotechniques. 2001, 31 (5): 1140-1149.PubMedGoogle Scholar
  31. Puig O, Caspary F, Rigaut G, Rutz B, Bouveret E, Bragado-Nilsson E, Wilm M, Séraphin B: The tandem affinity purification (TAP) method: a general procedure of proteincomplex purification. Methods. 2001, 24 (3): 218-229. 10.1006/meth.2001.1183.View ArticlePubMedGoogle Scholar
  32. Fischer M, Haase I, Simmeth E, Gerisch G, Müller-Taubenberger A: A brilliant monomeric red fluorescent protein to visualize cytoskeletondynamics in Dictyostelium. FEBS Lett. 2004, 577 (1–2): 227-232.View ArticlePubMedGoogle Scholar
  33. Müller-Taubenberger A, Lupas AN, Li H, Ecke M, Simmeth E, Gerisch G: Calreticulin and calnexin in the endoplasmic reticulum are important forphagocytosis. EMBO J. 2001, 20 (23): 6772-6782. 10.1093/emboj/20.23.6772.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Schneider N, Schwartz JM, Köhler J, Becker M, Schwarz H, Gerisch G: Golvesin-GFP fusions as distinct markers for Golgi and post-Golgi vesicles inDictyostelium cells. Biol Cell. 2000, 92 (7): 495-511. 10.1016/S0248-4900(00)01102-3.View ArticlePubMedGoogle Scholar
  35. Charette SJ, Mercanti V, Letourneur F, Bennett N, Cosson P: A role for adaptor protein-3 complex in the organization of the endocyticpathway in Dictyostelium. Traffic. 2006, 7 (11): 1528-1538. 10.1111/j.1600-0854.2006.00478.x.View ArticlePubMedGoogle Scholar
  36. Ivaska J, Heino J: Interplay between cell adhesion and growth factor receptors: from the plasmamembrane to the endosomes. Cell Tissue Res. 2010, 339 (1): 111-120. 10.1007/s00441-009-0857-z.PubMed CentralView ArticlePubMedGoogle Scholar
  37. Mayor S, Presley JF, Maxfield FR: Sorting of membrane components from endosomes and subsequent recycling to thecell surface occurs by a bulk flow process. J Cell Biol. 1993, 121 (6): 1257-1269. 10.1083/jcb.121.6.1257.View ArticlePubMedGoogle Scholar
  38. Gruenberg J: The endocytic pathway: a mosaic of domains. Nat Rev Mol Cell Biol. 2001, 2 (10): 721-730. 10.1038/35096054.View ArticlePubMedGoogle Scholar
  39. Mellman I: Endocytosis and molecular sorting. Annu Rev Cell Dev Biol. 1996, 12: 575-625. 10.1146/annurev.cellbio.12.1.575.View ArticlePubMedGoogle Scholar
  40. van der Sluijs P, Hull M, Webster P, Mâle P, Goud B, Mellman I: The small GTP-binding protein rab4 controls an early sorting event on theendocytic pathway. Cell. 1992, 70 (5): 729-740. 10.1016/0092-8674(92)90307-X.View ArticlePubMedGoogle Scholar
  41. Sheff DR, Daro EA, Hull M, Mellman I: The receptor recycling pathway contains two distinct populations of earlyendosomes with different sorting functions. J Cell Biol. 1999, 145 (1): 123-139. 10.1083/jcb.145.1.123.PubMed CentralView ArticlePubMedGoogle Scholar
  42. Deneka M, Neeft M, Popa I, van Oort M, Sprong H, Oorschot V, Klumperman J, Schu P, van der Sluijs P: Rabaptin-5alpha/rabaptin-4 serves as a linker between rab4 andgamma(1)-adaptin in membrane recycling from endosomes. EMBO J. 2003, 22 (11): 2645-2657. 10.1093/emboj/cdg257.PubMed CentralView ArticlePubMedGoogle Scholar
  43. Bonifacino JS, Rojas R: Retrograde transport from endosomes to the trans-Golgi network. Nat Rev Mol Cell Biol. 2006, 7 (8): 568-579. 10.1038/nrm1985.View ArticlePubMedGoogle Scholar
  44. Johannes L, Popoff V: Tracing the retrograde route in protein trafficking. Cell. 2008, 135 (7): 1175-1187. 10.1016/j.cell.2008.12.009.View ArticlePubMedGoogle Scholar
  45. Zanchi R, Howard G, Bretscher MS, Kay RR: The exocytic gene secAis required for Dictyostelium cell motility andosmoregulation. J Cell Sci. 2010, 123: 3226-3234. 10.1242/jcs.072876.PubMed CentralView ArticlePubMedGoogle Scholar
  46. Lammermann T, Sixt M: Mechanical modes of “amoeboid” cell migration. Curr Opin Cell Biol. 2009, 21: 636-644. 10.1016/j.ceb.2009.05.003.View ArticlePubMedGoogle Scholar
  47. Kelsely JS, Fastman N, Noratel BF, Blumberg DD: Ndm, a coiled coildomain protein that suppresses macropinocytosis and haseffects on cell migration. Mol Biol Cell. 23: 1-14.
  48. Kimmel AR, Faix J: Generation of multiple knockout mutants using the Cre-loxP system. Methods Mol Biol. 2006, 346: 187-199.PubMedGoogle Scholar
  49. Harwood AJ, Drury L: New vectors for expression of the E.coli lacZ gene in Dictyostelium. Nucleic Acids Res. 1990, 18 (14): 4292-10.1093/nar/18.14.4292.PubMed CentralView ArticlePubMedGoogle Scholar
  50. Kuspa A: Restriction enzyme-mediated integration (REMI) mutagenesis. Methods Mol Biol. 2006, 346: 201-209.PubMedGoogle Scholar
  51. Duran MB, Rahman A, Colten M, Brazill D: Dictyostelium discoideum paxillin regulates actin-based processes. Protist. 2009, 160 (2): 221-232. 10.1016/j.protis.2008.09.005.PubMed CentralView ArticlePubMedGoogle Scholar
  52. Witke W, Schleicher M, Noegel AA: Redundancy in the microfilament system: abnormal development of Dictyosteliumcells lacking two F-actin cross-linking proteins. Cell. 1992, 68 (1): 53-62. 10.1016/0092-8674(92)90205-Q.View ArticlePubMedGoogle Scholar
  53. Kirsten JH, Xiong Y, Davis CT, Singleton CK: Subcellular localization of ammonium transporters in Dictyosteliumdiscoideum. BMC Cell Biol. 2008, 9: 71-10.1186/1471-2121-9-71.PubMed CentralView ArticlePubMedGoogle Scholar
  54. Zigmond SH, Joyce M, Borleis J, Bokoch GM, Devreotes PN: Regulation of actin polymerization in cell-free systems by GTPgammaS andCdc42. J Cell Biol. 1997, 138 (2): 363-374. 10.1083/jcb.138.2.363.PubMed CentralView ArticlePubMedGoogle Scholar
  55. Laemmli UK: Cleavage of structural proteins during the assembly of the head ofbacteriophage T4. Nature. 1970, 227 (5259): 680-685. 10.1038/227680a0.View ArticlePubMedGoogle Scholar
  56. Westphal M, Jungbluth A, Heidecker M, Mühlbauer B, Heizer C, Schwartz JM, Marriott G, Gerisch G: Microfilament dynamics during cell movement and chemotaxis monitored using aGFP-actin fusion protein. Curr Biol. 1997, 7 (3): 176-183. 10.1016/S0960-9822(97)70088-5.View ArticlePubMedGoogle Scholar

Copyright

© Noratel et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), whichpermits unrestricted use, distribution, and reproduction in any medium, provided theoriginal work is properly cited.